View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8027_low_6 (Length: 419)
Name: NF8027_low_6
Description: NF8027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8027_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 19 - 406
Target Start/End: Original strand, 454155 - 454542
Alignment:
| Q |
19 |
ctactaccgcgcttgttttgtttcttgagatggttagagatgggttgagaccgaatgagtttgcgttatcgagtttggtgaagtcttgtgggtttttagg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
454155 |
ctactaccgcgcttgttttgtttcttgagatggttagagatgggttgagaccgaatgagtttgcgttgtcgagtttggtgaagtgttgtgggtttttagg |
454254 |
T |
 |
| Q |
119 |
gagttgtgttgatgggaagcagattcatgggtgttgttggaaatatgggtttcaggagaatgtgtttgttgggagttcgcttgtggatatgtatgcgagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454255 |
gagttgtgttgatgggaagcagattcatgggtgttgttggaaatatgggtttcaggagaacgtgtttgttgggagttcgcttgtggatatgtatgcgagg |
454354 |
T |
 |
| Q |
219 |
tgtggggagttaagggaagcgcggttggtttttgatgagcttgagagtaaaaatgaggtttcgtggaatgctttgatatctggttttgcgaggaaaggtg |
318 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454355 |
tgtggggagttaagggaatcacggttggtttttgatgagcttgagagtaaaaatgaggtttcgtggaatgctttgatatctggttttgcgaggaaaggtg |
454454 |
T |
 |
| Q |
319 |
aaggagaggaggctttgggtttgtttgtgaagatgcaaagggagggttttggagcgactgagtttacttattccgctttattgtgttc |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454455 |
aaggagaggaggctttgggtttgtttgtgaagatgcaaagggagggttttggagcgactgagtttacttattccgctttattgtgttc |
454542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University