View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8027_low_9 (Length: 273)
Name: NF8027_low_9
Description: NF8027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8027_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 22 - 259
Target Start/End: Original strand, 31781594 - 31781831
Alignment:
| Q |
22 |
tcatcctgataatttccatttctatcatcagcagcaacagttgcagagtcaacaaacgttttctgttagttctgttaaagttgagttgcagcatttggtt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31781594 |
tcatcctgataatttccatttctatcatcagcagcaacagttgcagagtcaacaaacgttttctgttagttctgttaaagttgagttgcagcatttggtt |
31781693 |
T |
|
| Q |
122 |
ttgtctgttcttgatgacccggttgttagtagagttttcgctgaagctggttttcgaagctccgagattaagcttgcaattctccggccacttccgcatc |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31781694 |
ttgtcagttcttgatgacccggttgttagtagagttttcgctgaagctggttttcgaagctccgagattaagcttgcaattctccggccacttccccatc |
31781793 |
T |
|
| Q |
222 |
tcttccgtagtggtccaccggtttttctgtgtaacctg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31781794 |
tcttccgtcgtggtccaccggtttttctgtgtaacctg |
31781831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 98 - 182
Target Start/End: Original strand, 25773212 - 25773296
Alignment:
| Q |
98 |
aaagttgagttgcagcatttggttttgtctgttcttgatgacccggttgttagtagagttttcgctgaagctggttttcgaagct |
182 |
Q |
| |
|
|||||||||||| ||||||| || | ||| |||||||||| || | |||||||| ||||| || |||||||||||||| |||| |
|
|
| T |
25773212 |
aaagttgagttgaagcatttcattctctctattcttgatgatcctatagttagtagggtttttgcagaagctggttttcgtagct |
25773296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University