View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8028_high_8 (Length: 239)
Name: NF8028_high_8
Description: NF8028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8028_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 4 - 226
Target Start/End: Original strand, 20280189 - 20280416
Alignment:
| Q |
4 |
gttccattaataatgtcagtattacagatttatgtggtagatagcatactagagactatgaaaggatttggaggtttataga-----ggccaataataga |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20280189 |
gttccattaataatgtcagtattacagatttatgtggtagatagcacactagagactatgaaaggatttggaggtttatagatatttggccaataataga |
20280288 |
T |
 |
| Q |
99 |
atctttgttaatgtatttgtgacaaaagaaaactctagtgtaatggaagacatagaacacaagtttttatcattgctagaacacaagtgtaatggatatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20280289 |
atctttgttaatgtatttgtgacaaaagaaaactctagtgtaatggaagacatagaacacaagtttttatctttgctagaacacaagtgtaatggatatt |
20280388 |
T |
 |
| Q |
199 |
atggaacagagcttgcgatctttgtttt |
226 |
Q |
| |
|
||||||||||| |||||| ||||||||| |
|
|
| T |
20280389 |
atggaacagagtttgcgacctttgtttt |
20280416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University