View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8029_high_14 (Length: 268)
Name: NF8029_high_14
Description: NF8029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8029_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 72 - 260
Target Start/End: Original strand, 13281785 - 13281973
Alignment:
| Q |
72 |
tatatttattttcaagtataagaggtagaagtatttgtttggttttacctgttttatttcattggttactctctttctatggcatattggactggttttt |
171 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13281785 |
tatatttattttcatgtataagaggtagaagtatttgtttggttttaccttttttatttcattggttactctctttctatggcatattggactggttttt |
13281884 |
T |
 |
| Q |
172 |
atttttattgtatggacgagatgtaatgtgaaaagtataagtttgaacttcaatatgattacaatgtatactctgattgtttctctgct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13281885 |
atttttattgtatggacgagatgtaatgtgaaaagtataagtttgaacttcaatatgattacaatgtatactctgattgtttctctgct |
13281973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University