View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8029_high_18 (Length: 251)

Name: NF8029_high_18
Description: NF8029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8029_high_18
NF8029_high_18
[»] chr5 (1 HSPs)
chr5 (98-232)||(18297761-18297894)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 98 - 232
Target Start/End: Complemental strand, 18297894 - 18297761
Alignment:
98 ttagtgtttggtagggatattgaggtatgcatgcatatcgaggtttgaacccacttatttcaacacatccaaatcattttgatccattgtagcagcacat 197  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
18297894 ttagtgtttggtagggatattgaggtatgca-gcatatcgaggtttgaacccacttatttcaacacatccaaatcgttttgatccattgtagcagcacat 18297796  T
198 gggtggtgaactcgccctcggcatcaccacctctt 232  Q
    ||||||||||||||||||||| |||||||||||||    
18297795 gggtggtgaactcgccctcggtatcaccacctctt 18297761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University