View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8029_high_18 (Length: 251)
Name: NF8029_high_18
Description: NF8029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8029_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 98 - 232
Target Start/End: Complemental strand, 18297894 - 18297761
Alignment:
| Q |
98 |
ttagtgtttggtagggatattgaggtatgcatgcatatcgaggtttgaacccacttatttcaacacatccaaatcattttgatccattgtagcagcacat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18297894 |
ttagtgtttggtagggatattgaggtatgca-gcatatcgaggtttgaacccacttatttcaacacatccaaatcgttttgatccattgtagcagcacat |
18297796 |
T |
 |
| Q |
198 |
gggtggtgaactcgccctcggcatcaccacctctt |
232 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18297795 |
gggtggtgaactcgccctcggtatcaccacctctt |
18297761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University