View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8029_low_12 (Length: 315)
Name: NF8029_low_12
Description: NF8029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8029_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 55 - 298
Target Start/End: Complemental strand, 38818571 - 38818328
Alignment:
| Q |
55 |
ataatagtggctcgttcgttcataaatgaactcgaccacttgttagtcttgctacacgacacgagtctagggtgaagttgaagcagacacggtcaagtaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38818571 |
ataatagtggctcgttcgttcataaatgaactcgaccacttgttagtcttgctacacgacacgagtctagggtgaagttgaagcagacacggtcaagtaa |
38818472 |
T |
 |
| Q |
155 |
agtcgactttacaagtgattcaacataccatatctacggatggaaataaaaaaggagaactccgtgcctctttaccatctcattgatgcacatctcggcg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38818471 |
agtcgactttacaagtgattcaacataccatatctacggatggaaataaaaaaggagaactccgtgcctctttaccatcttattgatgcacatctcggcg |
38818372 |
T |
 |
| Q |
255 |
agttttgcgaaagtcgtgcgggtcttgaatgggattaggaatct |
298 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38818371 |
agtttcgcgaaagtcgtgcgggtcttgaatgggattaggaatct |
38818328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 253 - 285
Target Start/End: Complemental strand, 12363046 - 12363014
Alignment:
| Q |
253 |
cgagttttgcgaaagtcgtgcgggtcttgaatg |
285 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
12363046 |
cgagtttcgcgaaagtcgtgcgggtcttgaatg |
12363014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 297
Target Start/End: Original strand, 12363037 - 12363073
Alignment:
| Q |
261 |
gcgaaagtcgtgcgggtcttgaatgggattaggaatc |
297 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12363037 |
gcgaaactcgtgcgggtcttgaatgggattgggaatc |
12363073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University