View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8029_low_16 (Length: 268)

Name: NF8029_low_16
Description: NF8029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8029_low_16
NF8029_low_16
[»] chr2 (1 HSPs)
chr2 (72-260)||(13281785-13281973)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 72 - 260
Target Start/End: Original strand, 13281785 - 13281973
Alignment:
72 tatatttattttcaagtataagaggtagaagtatttgtttggttttacctgttttatttcattggttactctctttctatggcatattggactggttttt 171  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
13281785 tatatttattttcatgtataagaggtagaagtatttgtttggttttaccttttttatttcattggttactctctttctatggcatattggactggttttt 13281884  T
172 atttttattgtatggacgagatgtaatgtgaaaagtataagtttgaacttcaatatgattacaatgtatactctgattgtttctctgct 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13281885 atttttattgtatggacgagatgtaatgtgaaaagtataagtttgaacttcaatatgattacaatgtatactctgattgtttctctgct 13281973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University