View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8030_low_10 (Length: 262)
Name: NF8030_low_10
Description: NF8030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8030_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 20039891 - 20040045
Alignment:
| Q |
1 |
cttcttcgaaaagatggggtatgagaaggaggtggtgaagggcaatattaatattaatgggaatgatgattctaatgtcatcatgatgaagaaactcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
20039891 |
cttcttcgaaaagatggggtatgagaaggaggtggtgaagggcaata---atattaatgggaatgatgatgctaatgtcatcatgatgaagaagctcaag |
20039987 |
T |
 |
| Q |
101 |
gggaagcagatgcattctgcggagaccgaaggtaatccaaaaggcacttgattgttag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20039988 |
gggaagcagatgcattctgcggagaccgaaggtaatccaaaaggcacttgattgttag |
20040045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 20040242 - 20040280
Alignment:
| Q |
154 |
gttagtaagtgtgtgattctattcatgatattaaagtttg |
193 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20040242 |
gttagtaagtgtgtgattctattc-tgatattaaagtttg |
20040280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University