View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8030_low_8 (Length: 296)
Name: NF8030_low_8
Description: NF8030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8030_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 63 - 256
Target Start/End: Original strand, 26454237 - 26454427
Alignment:
| Q |
63 |
gaatagtaacgccatttcattcattgaagaatcataatatcttttttccaattatttagaagttgatggagaaagttgtaacaaagtatcttattcccac |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454237 |
gaatagtaacgccaattcattcattgaagaatcatcatatcttttttccaattatttagaagttgatggagaaagttgtaacaaagtatcttattcccac |
26454336 |
T |
 |
| Q |
163 |
gtgttgttaactacgcatattgcagatgcatttttgcattagatactgcatgaccaaagcacatggccagcctttgcattgcaaccaccttttc |
256 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454337 |
g---tgttaactacgcatattgcagatgcatttttgcattagatactgcatgaccaaagcacatggccagcctttgcattgcaaccaccttttc |
26454427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 26454184 - 26454220
Alignment:
| Q |
19 |
aacaacgcataaagatgcacaatattatggggataag |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454184 |
aacaacgcataaagatgcacaatattatggggataag |
26454220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University