View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8030_low_9 (Length: 277)
Name: NF8030_low_9
Description: NF8030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8030_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 25 - 263
Target Start/End: Complemental strand, 25514797 - 25514555
Alignment:
| Q |
25 |
ttctctctacatactcaaaccacttaaaatgtacaaagaattaagttctcaaaatgcactctttaagatgcatcaaccaagttctctaaatgcactctcc |
124 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
25514797 |
ttctctctacatgctcaaaccacttaaaatgcacaaagaattaagttcttaaaatgcactctttaagatgcatcaaccaaattctcaaaatgcactctct |
25514698 |
T |
 |
| Q |
125 |
aggttgcatcaacca--ctcatagaataagcaccttagatttttaacacactcatcactttgttgtgtgttaaaatctagaagaa---nnnnnnnncaaa |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25514697 |
aggttgcatcaaccactctcatagaataagcaccttagatttttaacacactcatcactttgttgtgtgttaaaatctagaagaatttttttttttcaac |
25514598 |
T |
 |
| Q |
220 |
cctaatacaaaaataaattcgatgtcgacccctacgagtattat |
263 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25514597 |
cctaatac-aaaataaattcgatgtcgacccctacgagtattat |
25514555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University