View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8033_high_7 (Length: 204)
Name: NF8033_high_7
Description: NF8033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8033_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 188
Target Start/End: Original strand, 4325858 - 4326026
Alignment:
| Q |
20 |
gaaggaagagatgagagagcatgaatatatcacttgcaaattgcaattacttgtcaacttggcaaatggtatattgcatatagttttgttaatttaggag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4325858 |
gaaggaagagatgagagagcatgaatatatcacttgcaaattgcaattacttgtcaacttggcaaatggtatattgcatatagttttgttaatttaggag |
4325957 |
T |
|
| Q |
120 |
gttgattcttcttaaacaaaatgtaaatgttttacattggaataggcatatatatgttgtccatttcat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4325958 |
gttgattcttcttaaacaaaatgtaaatgttttacattggaataggcatatatatgttgtccatttcat |
4326026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 55 - 157
Target Start/End: Original strand, 4331433 - 4331535
Alignment:
| Q |
55 |
gcaaattgcaattacttgtcaacttggcaaatggtatattgcatatagttttgttaatttaggaggttgattcttcttaaacaaaatgtaaatgttttac |
154 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||| |||| ||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
4331433 |
gcaaattgcaactacttgtcaactttgcagatgatatagtgcctatagttttgttaatttagaaggttgattcttcttaaacaaaatgtaaatgtttcac |
4331532 |
T |
|
| Q |
155 |
att |
157 |
Q |
| |
|
||| |
|
|
| T |
4331533 |
att |
4331535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University