View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8033_low_7 (Length: 270)
Name: NF8033_low_7
Description: NF8033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8033_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 48536505 - 48536251
Alignment:
| Q |
1 |
gccgggttaaactgtgttgcgggctatgtggcactagcagt-----tagcagtctgtgattccaatcccgtctgtcattccaatcccaatacgatgactg |
95 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536505 |
gccgggttaaactgcgttgcgggctatgttgcactagcagtagctttagcagtctgtgattccaatcccgtctgtcattccaatcccaatacgatgacta |
48536406 |
T |
|
| Q |
96 |
aggtattaatatcttttgtaccaatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacatagatcagatcaacactcg |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536405 |
aggtactaatatcttttgtaccaatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacatagatcagatcaacactcg |
48536306 |
T |
|
| Q |
196 |
tagattctgggtcctcaggctattggggtatcttacatctctatgtggcttatgtt |
251 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48536305 |
tagattccgggtcctcaggctatt-gggtatcttacatctctatgtggcttatgtt |
48536251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 117 - 249
Target Start/End: Complemental strand, 48533452 - 48533320
Alignment:
| Q |
117 |
caatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacatagatcagatcaacactcgtagattctgggtcctcaggct |
216 |
Q |
| |
|
||||||||||||| |||||| ||||||||| | |||| | | || |||||||||||| ||||||||||||||||| || ||| | ||| || | | |
|
|
| T |
48533452 |
caatttgcttctttgcaagtggcgccttcttctttagcctcgcaagagacctctctcacaaagatcagatcaacactcataccttccgcatccgcaagtt |
48533353 |
T |
|
| Q |
217 |
attggggtatcttacatctctatgtggcttatg |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
48533352 |
attggggtctcttacatctctatgtggcttatg |
48533320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University