View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8034_low_10 (Length: 237)
Name: NF8034_low_10
Description: NF8034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8034_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 44852325 - 44852557
Alignment:
| Q |
1 |
ttggtgctctcatataaaaagttaattcaaatggtagagaatcattttaaactagatcataactaggctgatatagtannnnnnnn---------ctagt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44852325 |
ttggtgctctcatataaaaagttaattcaaatggtagagaatcattttaaactagatcataactaggctgatatagtatttttatttttttttttctagt |
44852424 |
T |
 |
| Q |
92 |
aaaagataccacgaggttcacgcgttttagtgctttgtatttacatttacattttgcagcactgagtagaacgaggttttacttttcttgggtgcctcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44852425 |
aaaagataccacgaggttcacgcgttttagtgctttgtatttacatttacattttgcagcactgagtagaacgaggttttacttttcttgggtgcctcat |
44852524 |
T |
 |
| Q |
192 |
atgatggatggaggagaaagtgttgttttcttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44852525 |
atgatggatggaggagaaagtgttgttttcttt |
44852557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University