View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8034_low_11 (Length: 233)

Name: NF8034_low_11
Description: NF8034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8034_low_11
NF8034_low_11
[»] chr3 (2 HSPs)
chr3 (18-127)||(47230465-47230574)
chr3 (169-221)||(47230614-47230666)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 127
Target Start/End: Original strand, 47230465 - 47230574
Alignment:
18 tcttctaacaattcaagcaatcgtggttcaaaggaaagcttttcattcatactagcttctggaccaagcaaaaaaggccctggacattgagttatattca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47230465 tcttctaacaattcaagcaatcgtggttcaaaggaaagcttttcattcatactagcttctggaccaagcaaaaaaggccctggacattgagttatattca 47230564  T
118 ttctttgcca 127  Q
    ||||||||||    
47230565 ttctttgcca 47230574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 47230614 - 47230666
Alignment:
169 ctctagactctaggttatagatattgaattcttccatggccatttttcttctc 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
47230614 ctctagactctaggttatagatattgaattcttccatggccatttttcttctc 47230666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University