View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8034_low_11 (Length: 233)
Name: NF8034_low_11
Description: NF8034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8034_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 18 - 127
Target Start/End: Original strand, 47230465 - 47230574
Alignment:
| Q |
18 |
tcttctaacaattcaagcaatcgtggttcaaaggaaagcttttcattcatactagcttctggaccaagcaaaaaaggccctggacattgagttatattca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47230465 |
tcttctaacaattcaagcaatcgtggttcaaaggaaagcttttcattcatactagcttctggaccaagcaaaaaaggccctggacattgagttatattca |
47230564 |
T |
|
| Q |
118 |
ttctttgcca |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
47230565 |
ttctttgcca |
47230574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 47230614 - 47230666
Alignment:
| Q |
169 |
ctctagactctaggttatagatattgaattcttccatggccatttttcttctc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47230614 |
ctctagactctaggttatagatattgaattcttccatggccatttttcttctc |
47230666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University