View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8034_low_13 (Length: 228)
Name: NF8034_low_13
Description: NF8034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8034_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 4373192 - 4373395
Alignment:
| Q |
10 |
agtgagatgaatgacgaaacatcggaggagatggatgaatttacgatactttatgggattgtggatcacatcagagaaaaatatgggtaagacatgggat |
109 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4373192 |
agtgagaggaatgatgaaacatcggaggagatggacgaatttaccatactttatgggattgtggatcacatcagagaaagatatgggtaagacatgggat |
4373291 |
T |
 |
| Q |
110 |
ttcaaatacatgacaatgatctggaattctagaatattgtcagtcttgagagccgatggagtggagtgcgagcttgcattatactatagtaccacctagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
4373292 |
ttcaaatacatgacaatgatctggaattctagaatattgtcagtcttgagagccgatggagtggagtgtgggcttgcattatactatagtaccacctagt |
4373391 |
T |
 |
| Q |
210 |
ttct |
213 |
Q |
| |
|
|||| |
|
|
| T |
4373392 |
ttct |
4373395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University