View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8037_low_8 (Length: 203)
Name: NF8037_low_8
Description: NF8037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8037_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 90 - 196
Target Start/End: Complemental strand, 883505 - 883399
Alignment:
| Q |
90 |
acttatccatctcatacaacgtagcaacggcgagctggctccatcatcctccattcctgttaaagacccctctcatatccgcttaggccatcatctctgc |
189 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
883505 |
acttatccatctcatacaacatagcaacggcgagctggctccatcatcctccattcctgttaaagacccctctcatatccgcttaggccatcatctttgc |
883406 |
T |
|
| Q |
190 |
tcctcca |
196 |
Q |
| |
|
| ||||| |
|
|
| T |
883405 |
ttctcca |
883399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 883568 - 883523
Alignment:
| Q |
21 |
agttgagacccctgactttggagagttaaaggttatatggttgcgc |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
883568 |
agttgagacccctgactttggagagttaaagattatatggttgcgc |
883523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University