View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8038_high_4 (Length: 272)
Name: NF8038_high_4
Description: NF8038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8038_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 255
Target Start/End: Original strand, 267203 - 267438
Alignment:
| Q |
20 |
tgttaaacggagggcacatgaagaaagcggttatatttgtacaatgaaatgtcttccaagggaatgaaaccatcaacggtcttttaacttaatttaaagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267203 |
tgttaaacggagggcacatgaagaaagcggttatatttgtacaatgaaatgtcttccaagggaatgaaaccatcaacggtcttttaacttaatttaaagt |
267302 |
T |
|
| Q |
120 |
ttctaacaggttgtttatcttgttttcggttcaaattaatcttgctttaccaaaaacgaaaagcgcaatttgtccaagccaggttgttcacttcgtggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
267303 |
ttctaacaggttgtttatcttgttttcggttcaaattaatcttgctttaccaaaaacgaaaagcgcaatttgtccaagccaggttgttcacttcttggtg |
267402 |
T |
|
| Q |
220 |
tgctataattatctctctatcatatcatatgatgtc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
267403 |
tgctataattatctctctatcatatcatatcatgtc |
267438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University