View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8038_low_11 (Length: 225)
Name: NF8038_low_11
Description: NF8038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8038_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 39497630 - 39497434
Alignment:
| Q |
19 |
ctaactactatttaattaccaatattttggagcacaaaatatcaactgatccnnnnnnnnn--gacaggaatttt-atcatcaagtcttttgtttttgtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
39497630 |
ctaactactatttaattaccaatattttggagcacaaaatatcaactgatccaaaaaaaaaaagacaagaatttttatcatcaagtcttttgtttttgtc |
39497531 |
T |
 |
| Q |
116 |
nnnnnnnntaaatcataaaatcttttgttatttgaaataattattgtagaattcttttatttaactgaaaaatccaaccatagaggctgtctctgct |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39497530 |
aaaaaaaataaatcataaagtcttttgttatttgaaataattattgtagaattcttttatttaactgaaaaatccaaccatagaggctgtctatgct |
39497434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University