View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8039_low_22 (Length: 239)
Name: NF8039_low_22
Description: NF8039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8039_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 28519838 - 28519617
Alignment:
| Q |
1 |
tcttatatgcaaatcatagctttcttttgtttagagcaaatgagtctgaaacaaagatttgaaagatattctggatacttttgctaaagcctcatgtcag |
100 |
Q |
| |
|
|||||| | ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28519838 |
tcttattttcaaatgatagctttcttttatttagagcaaatgagtctgaaacaaagatttgaaaggtattctggatacttttgctaaagcctcatgtcag |
28519739 |
T |
 |
| Q |
101 |
ttgatcaatatgnnnnnnntcatagatattttttagtaggaatcctctgcggtaaaaggctaccctccctaatattcttcaagtgacggagtgtattggg |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28519738 |
ttgatcaatatg-aaaaaatcatagatattttttagtaggaatcccctacggt-aaaggctaccctccctaatattcttcaaatgacggagtgtattggg |
28519641 |
T |
 |
| Q |
201 |
acggaaaaatatttaggactccct |
224 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
28519640 |
acgggaaaatatttaggactccct |
28519617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University