View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8040_low_10 (Length: 242)
Name: NF8040_low_10
Description: NF8040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8040_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 26411814 - 26411644
Alignment:
| Q |
16 |
ataacagcgtgcatgggaatgttatcagaataaatggaaaggaaagatgactcagcatgcacaaatgacactctcactagatccttcttctcatggtttg |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
26411814 |
ataacagcgtgcatgggaatgtcatcagaataaatggaaaagaaagatgactcagcatgcacaaaggacactc--actagattcttcttctcatggtttg |
26411717 |
T |
|
| Q |
116 |
gtaattccctcaaagagaagactcatgcctcatagtgtttatttgtctccattacccacctccgtcttttgaaat |
190 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26411716 |
gtaattccctca--gagaagactcatgcctcatagtgtttatttgtctccattacccacctccgtcttttgaaat |
26411644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 226
Target Start/End: Complemental strand, 26411610 - 26411572
Alignment:
| Q |
188 |
aatgtcttcgtaaggtgaattgttacagtgccaaagaat |
226 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26411610 |
aatgtcttcctaaggtgaattgttacagtgccaaagaat |
26411572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 103
Target Start/End: Complemental strand, 1528799 - 1528723
Alignment:
| Q |
27 |
catgggaatgttatcagaataaatggaaaggaaagatgactcagcatgcacaaatgacactctcactagatccttct |
103 |
Q |
| |
|
|||||||||||| ||| ||| | ||||| ||| | |||||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
1528799 |
catgggaatgttctcaaaattatcggaaaagaatggtgactcagcatgcacaaaggacaccctctctagatccttct |
1528723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University