View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8043_high_6 (Length: 223)
Name: NF8043_high_6
Description: NF8043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8043_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 5794084 - 5793943
Alignment:
| Q |
17 |
caatttacataattgtaattttacttcaacatgtatacattaattaattttattcgtttgggaggagcaattgatgtttgattgta-nnnnnnngttggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5794084 |
caatttacataattgtaattttacttcaggatgtatacattaattaattttattcgtttgggtggagcaattgatgtttgattgtattttttttgttggg |
5793985 |
T |
 |
| Q |
116 |
tattgattttgtgcagaaaaatgagagtgatatgtggacttc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5793984 |
tattgattttgtgcagaaaaatgagagtgatatgtggacttc |
5793943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 219
Target Start/End: Original strand, 9374613 - 9374652
Alignment:
| Q |
180 |
ggtaatacgtaacttattttatgattaaactcaaaattat |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9374613 |
ggtaatacgtaacttattttctgattaaactcaaaattat |
9374652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University