View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8043_high_7 (Length: 202)
Name: NF8043_high_7
Description: NF8043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8043_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 13 - 155
Target Start/End: Original strand, 29197800 - 29197942
Alignment:
| Q |
13 |
gacatcattggaggagatcacttgagtgatgaaggattttgaatcaaaacgagcatcaatagttgcaatgaagcttaagaggaaaagcaacataactaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
29197800 |
gacatcattggaggagatcacttgagtgatgaaggattttgaatcaaaacgagcatcaatagttgcaatgaagcttaagaggaaaatcaacatagctaac |
29197899 |
T |
|
| Q |
113 |
tttatcattgccttcttgttcgtcaagcccattattaccctct |
155 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
29197900 |
tttatcattgtcttcttgttcatcaagcccattattactctct |
29197942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 152 - 187
Target Start/End: Original strand, 29197964 - 29197999
Alignment:
| Q |
152 |
ctctaatttatttgacttgtgaagagccaaccatgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29197964 |
ctctaatttatttgacttgtgaagagccaaccatgt |
29197999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 71
Target Start/End: Original strand, 29153640 - 29153685
Alignment:
| Q |
26 |
gagatcacttgagtgatgaaggattttgaatcaaaacgagcatcaa |
71 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
29153640 |
gagatcacttgagttatgaaggatgttgaatcgaaacgagcatcaa |
29153685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University