View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8043_low_15 (Length: 223)

Name: NF8043_low_15
Description: NF8043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8043_low_15
NF8043_low_15
[»] chr8 (1 HSPs)
chr8 (17-157)||(5793943-5794084)
[»] chr6 (1 HSPs)
chr6 (180-219)||(9374613-9374652)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 5794084 - 5793943
Alignment:
17 caatttacataattgtaattttacttcaacatgtatacattaattaattttattcgtttgggaggagcaattgatgtttgattgta-nnnnnnngttggg 115  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||||||||||||||||||||        ||||||    
5794084 caatttacataattgtaattttacttcaggatgtatacattaattaattttattcgtttgggtggagcaattgatgtttgattgtattttttttgttggg 5793985  T
116 tattgattttgtgcagaaaaatgagagtgatatgtggacttc 157  Q
    ||||||||||||||||||||||||||||||||||||||||||    
5793984 tattgattttgtgcagaaaaatgagagtgatatgtggacttc 5793943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 219
Target Start/End: Original strand, 9374613 - 9374652
Alignment:
180 ggtaatacgtaacttattttatgattaaactcaaaattat 219  Q
    |||||||||||||||||||| |||||||||||||||||||    
9374613 ggtaatacgtaacttattttctgattaaactcaaaattat 9374652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University