View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8043_low_9 (Length: 315)
Name: NF8043_low_9
Description: NF8043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8043_low_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 315
Target Start/End: Original strand, 21126885 - 21127184
Alignment:
| Q |
16 |
cgccgccaaactcaaactcgaactaaccaatgtcactatctcttcccttttctccaccctctgccaccaccctaccaccacacttccgccacaacctccg |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21126885 |
cgccgccaaactcaaactcgaactcaccaatgtcactatcacttcccttttctccaccctctgccaccaccctaccaccacacttccgccacaacctcca |
21126984 |
T |
 |
| Q |
116 |
ccgtctccaagaaaactccctttcacagtgtctgttcacggcaggacatgggaggacccatatcactggatgtccaacaccgacgatccccatttgttgg |
215 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21126985 |
ccctccccaagaaaactccctttcacagtgtctgttcacggcaggacatgggaggacccatatcactggatgtccaacaccgacgatcctcatttgttgg |
21127084 |
T |
 |
| Q |
216 |
aacatctcaaccgtgaaaatagttatgctgatgcattcatggctgatactctcaaacttcgctctcagttgtcttcagagatgaaagcacgattgcctcc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21127085 |
aacatctcaaccgtgaaaatagttatgctgatgcattcatggctgatactctcaaacttcgctctcagttgtcttctgagatgaaagcacgattgcctcc |
21127184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University