View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8044_high_11 (Length: 294)
Name: NF8044_high_11
Description: NF8044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8044_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 54032612 - 54032894
Alignment:
| Q |
1 |
caatggacatttgattaaaatttcaacacaggtgccgatttcttcatcttgcccggatcatatattgtcgactttttggatgtgtctcttcgccacaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54032612 |
caatggacatttgattaaaatttcaacacaggtgccgatttcttcatcttgcccggatcatatattgtcgactttttggatgtgtctcttcgccacaata |
54032711 |
T |
 |
| Q |
101 |
cagtcagctatatttgcactgatcaaagaggggaatcttcaagtatggactttgaattcatctttacaaatttcatgcagtttatatgcagtaagtctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54032712 |
cagtcagctatatttgcactgatcaaagaggggaatcttcgagtatggactttgaattcacctttacaaatttcatgcagtttatatgcagtaagtctct |
54032811 |
T |
 |
| Q |
201 |
aacaggtccctcggaaacatttcaatctgtatcatctattacaatgttgtgtaatactgttagaaattggtgttttttgtgat |
283 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54032812 |
aacaggtccctcggaaacatttcaatttgtatcatctattacaatgttgtgtaatactgttagaaattggtgttttttgtgat |
54032894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University