View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8044_high_19 (Length: 242)

Name: NF8044_high_19
Description: NF8044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8044_high_19
NF8044_high_19
[»] chr4 (1 HSPs)
chr4 (1-227)||(40409377-40409603)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40409603 - 40409377
Alignment:
1 aaactcactttggagagcaaagtaaccagtaatatcaatcatctattcaaaaaagctaattgtaatattacatacgtgagtatcttttttaatgacgaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||    
40409603 aaactcactttggagagcaaagtaaccagtaatatcaatcatctattcaaaaaagttaattgtaatattacatacgtgagtatattttttaatgacaaaa 40409504  T
101 ttttaacatacacttcgaggatttacaaatacttcatgggtataaatcaaatagaaatcctagcaatgtggacatatgaacnnnnnnnncggtcggcact 200  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||    
40409503 ttttaacatacacttcgaggatttgcaaatacttcatgggtataaatcaaatagaaatcctagcaatgtggacatatgaacaaaaaaaacggtcggcact 40409404  T
201 ccacaataatctcgcaagtttgatttt 227  Q
    |||||||||||||||||||||||||||    
40409403 ccacaataatctcgcaagtttgatttt 40409377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University