View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8044_low_19 (Length: 251)
Name: NF8044_low_19
Description: NF8044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8044_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 10 - 205
Target Start/End: Complemental strand, 40409843 - 40409646
Alignment:
| Q |
10 |
aagaatatgttgttcctgcattattagcttttaacctagtcattagaatcataatcaaagggtgcatgtgtttaat-ttactattgttaaggatcgtgaa |
108 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40409843 |
aagaacatgttgttcctgcattattggcttttaacctagtcattagaatcataatcaaagggtgcatgtgtttaatattactattgttaaggatcgtgaa |
40409744 |
T |
 |
| Q |
109 |
gcaatagtgtatgatcatcacg-tattttaggcgcattttatatgacaagagagggggaagtttattacctcatcttaagtggactacaataccaacg |
205 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40409743 |
gcaatagtgtatgatcatcacgtttttttaggcgcattgtatatgacaagagagggggaagtttattacctcatcataagtggattacaataccaacg |
40409646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University