View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8044_low_22 (Length: 242)
Name: NF8044_low_22
Description: NF8044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8044_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40409603 - 40409377
Alignment:
| Q |
1 |
aaactcactttggagagcaaagtaaccagtaatatcaatcatctattcaaaaaagctaattgtaatattacatacgtgagtatcttttttaatgacgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
40409603 |
aaactcactttggagagcaaagtaaccagtaatatcaatcatctattcaaaaaagttaattgtaatattacatacgtgagtatattttttaatgacaaaa |
40409504 |
T |
|
| Q |
101 |
ttttaacatacacttcgaggatttacaaatacttcatgggtataaatcaaatagaaatcctagcaatgtggacatatgaacnnnnnnnncggtcggcact |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40409503 |
ttttaacatacacttcgaggatttgcaaatacttcatgggtataaatcaaatagaaatcctagcaatgtggacatatgaacaaaaaaaacggtcggcact |
40409404 |
T |
|
| Q |
201 |
ccacaataatctcgcaagtttgatttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40409403 |
ccacaataatctcgcaagtttgatttt |
40409377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University