View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8044_low_9 (Length: 410)
Name: NF8044_low_9
Description: NF8044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8044_low_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 18 - 410
Target Start/End: Original strand, 51674178 - 51674576
Alignment:
| Q |
18 |
gaggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcggggagaaaagagggtgttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
51674178 |
gaggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagaggttgttag |
51674277 |
T |
|
| Q |
118 |
gggtgtaaccgccatcatga------tgatgatgaaagtgaatttgcattgaattgaatggtgaatttgttgtatgatatatgatcgtgttacgtgtata |
211 |
Q |
| |
|
|| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51674278 |
ggttgtaaccgccatgatgatgatgatgatgatgaaagtgaatttgcattgaattgaatggtgaatttgttgtatgatatatgatcgtgttacgtgtata |
51674377 |
T |
|
| Q |
212 |
tggttctggtgaaccggtttggttttaacggttcaaatttgattgttcgttagctttagatgttactatcatgattcatgaacaccgccttgaacgttgc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51674378 |
tggttctggtgaaccggtttggttttaacggttcaaatttgattgtttgttagctttagatgttactatcatgattcatgaacaccgccttgaacgttgc |
51674477 |
T |
|
| Q |
312 |
tttcacccagattgctccggcttcttctaaaaatgtattttaataatcctttttgctttatctgttcagttgtgtgctgtaaaggagtggttcatttca |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51674478 |
tttcacccagattgctccggcttcttctaaaaatgtattttaataatcctttttgctttatctgttcagttgtgtgctgtaaaggagtggttcatttca |
51674576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University