View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_high_25 (Length: 280)
Name: NF8045_high_25
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 42463482 - 42463615
Alignment:
| Q |
18 |
atatgttagtgttcatgtcgggggtgttagtgttcgtgttgggtccagtatccgtgcttcatagctacattgtaattgctatcagaagaaaataattttt |
117 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||| ||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
42463482 |
atatgttagtgttcgtgtcggtg-tgttagtgttcgtgttgtgtccagtatccgtgcttcatagctataatgtaattgttatcagaagaaaataattttt |
42463580 |
T |
|
| Q |
118 |
ggtttctcttgtagattgaattgaaatatgtgaaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463581 |
ggtttctcttgtagattgaattgaaatatgtgaaa |
42463615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 200 - 262
Target Start/End: Original strand, 42463663 - 42463725
Alignment:
| Q |
200 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggag |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463663 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggag |
42463725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University