View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8045_high_28 (Length: 250)

Name: NF8045_high_28
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8045_high_28
NF8045_high_28
[»] chr5 (1 HSPs)
chr5 (12-218)||(3526963-3527174)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 3526963 - 3527174
Alignment:
12 agtgagatgaagaggattttacctgggggctgcaatgacgacaggggaagagttggagaagaagctgaaaatttccaattacgaaatatcaggatataaa 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||    
3526963 agtgaaatgaagaggattttacctgggggctgcaatgacgacaggggaagagttggagaagaagctgaaaatttccaataaggaaatatcaggatataaa 3527062  T
112 tgcatggattgatgtaatctcattattattataaattgaattgatgaaagtagtgtac----ttatatggtagaattggaaaataaaaaagtaata-tcc 206  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||| |||    
3527063 tgcatgtattgatgtaatctcattattattataaattgaattgatgaaagtagtgtacttaattatatggtagaattggaaaataaaaaagtaatattcc 3527162  T
207 tctaaaaatcaa 218  Q
    ||||||||||||    
3527163 tctaaaaatcaa 3527174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University