View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_high_28 (Length: 250)
Name: NF8045_high_28
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 3526963 - 3527174
Alignment:
| Q |
12 |
agtgagatgaagaggattttacctgggggctgcaatgacgacaggggaagagttggagaagaagctgaaaatttccaattacgaaatatcaggatataaa |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
3526963 |
agtgaaatgaagaggattttacctgggggctgcaatgacgacaggggaagagttggagaagaagctgaaaatttccaataaggaaatatcaggatataaa |
3527062 |
T |
 |
| Q |
112 |
tgcatggattgatgtaatctcattattattataaattgaattgatgaaagtagtgtac----ttatatggtagaattggaaaataaaaaagtaata-tcc |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3527063 |
tgcatgtattgatgtaatctcattattattataaattgaattgatgaaagtagtgtacttaattatatggtagaattggaaaataaaaaagtaatattcc |
3527162 |
T |
 |
| Q |
207 |
tctaaaaatcaa |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3527163 |
tctaaaaatcaa |
3527174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University