View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_high_35 (Length: 219)
Name: NF8045_high_35
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 41307491 - 41307681
Alignment:
| Q |
17 |
atatgttatgttcgatcatgaaatactaaaatcttgtcatttgttcatttaatcgccaatgtttgcttcatggtttaacttgaagaaacacaatgagtat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41307491 |
atatgttatgttcgatcatgaaatactaaaatcttgtcatttgttcatttaatcgccaatgtttgcttcatggtttaacttgaagaaacacaatgagtat |
41307590 |
T |
 |
| Q |
117 |
ggttgatccgtcaaggctcgagatctacggtcagtgcaaggtggtaatgactttgagttggcgacattcagtctgtgacttccttcttctc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41307591 |
ggttgatccgtcaaggctcgagatctacggtcaatgcaaggtggtaatgactttgagttggcgacattcggtctgtgacttccttcttctc |
41307681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University