View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_low_26 (Length: 360)
Name: NF8045_low_26
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 34173836 - 34173968
Alignment:
| Q |
18 |
attacctgagggaatgaagtgctctgagcccaaacagaaccgtcatggccgagaatggcagccgcggtgaggtgatggccagtgccatcgatatcacaca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34173836 |
attacctgagggaatgaagtgctctgagcccaaacagaaccgtcatggccgagaatggcagccgcggtgaggtgatgaccagtgccatcgatatcacaca |
34173935 |
T |
|
| Q |
118 |
tcaaatgttcatccacataagtttgccacgaca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34173936 |
tcaaatgttcatccacataagtttgccacgaca |
34173968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 256 - 352
Target Start/End: Original strand, 34174072 - 34174168
Alignment:
| Q |
256 |
ttggtgagaatgctttaataatttgtttatgatagacaatcagtttttctctccattcaatgaattcaattccttccattcaacgtccccttcattt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34174072 |
ttggtgagaatgctttaataatttgtttatgatagacaatcagtttttctctccattcaatgaattcaattccttccattcaacgtccccttcattt |
34174168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 20 - 150
Target Start/End: Complemental strand, 43051540 - 43051410
Alignment:
| Q |
20 |
tacctgagggaatgaagtgctctgagcccaaacagaaccgtcatggccgagaatggcagccgcggtgaggtgatggccagtgccatcgatatcacacatc |
119 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| || |||||||| | |||||||| || | ||||| || || |||||||| |||||||||||| |
|
|
| T |
43051540 |
tacctgagggaaggaagagctctgagcccaaacagagccatcatggccaatgatggcagcggcagataggtggtgtccggtgccatcaatatcacacatc |
43051441 |
T |
|
| Q |
120 |
aaatgttcatccacataagtttgccacgaca |
150 |
Q |
| |
|
||||||||||| || |||||||||||||||| |
|
|
| T |
43051440 |
aaatgttcatcaacgtaagtttgccacgaca |
43051410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University