View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_low_33 (Length: 251)
Name: NF8045_low_33
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 10465126 - 10465364
Alignment:
| Q |
1 |
ccctacatttctttacattcccaaccaataatatttaagacttgggggccacaaaagggaaattcctgctgtagtgacccgtatgtatagacagaaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465126 |
ccctacatttctttacattcccaaccaataatatttaagacttgggggccacaaaagggaaattcctgctgtagtgacccgtatgtatagacagaaagaa |
10465225 |
T |
 |
| Q |
101 |
caacacctagagattccattttcaccatgttggtggcaagttctcaaattaatgaatgagcttaaaaaatatcagcgtgagaagcacgaggtgtccacat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465226 |
ccacacctagagattccattttcaccatgttggtggcaagttctcaaattaatgaatgagcttaaaaaatatcagcgtgagaagcacgaggtgtccacat |
10465325 |
T |
 |
| Q |
201 |
atccgggaccaataaatgcatcccacatcatacaatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465326 |
atccgggaccaataaatgcatcccacatcatacaatatt |
10465364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University