View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_low_36 (Length: 241)
Name: NF8045_low_36
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 13 - 225
Target Start/End: Complemental strand, 14735870 - 14735658
Alignment:
| Q |
13 |
aatatttaatttcttaatataatatagtacaactcaatgatgtgtgtcttactcactagactactagtatttgttgtgacnnnnnnnnnngtgtacaagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
14735870 |
aatatttaatttcttaatataatatagtacaattcaatgatgtgtgtcttacttattagactactagtatttgttgtgacttttttttttgtgtacaagc |
14735771 |
T |
 |
| Q |
113 |
taatgttannnnnnnattcacttaaaagtgaatctttataaactttgtagaagaagaaacaaggaaataaaaatcatgattttgtgattttcaaacaccc |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14735770 |
taatgttatttttttattcacttaaaagtgaatctttataaactttgtagaagaagaaacattgaaataaaaatcatgattttgtgattttcaaacaccc |
14735671 |
T |
 |
| Q |
213 |
ctttcaatcaatt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14735670 |
ctttcaatcaatt |
14735658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University