View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8045_low_37 (Length: 230)
Name: NF8045_low_37
Description: NF8045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8045_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 212
Target Start/End: Original strand, 44492466 - 44492670
Alignment:
| Q |
10 |
gtcgaagaatatcatgtgctcacttctcgaaactctgtcaggggattcaacccaatgagatat--atatttatcaaactataactaatttgatatctgta |
107 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44492466 |
gtcgaaaattatcatgtgctcacttctcgaaactctgtcaggggattcaacccaatgagatatatatatttatcaacctataactaatttgatatctgta |
44492565 |
T |
 |
| Q |
108 |
atggccaagaactatattgttcttcctaactatatgctatttttatatgcgttaatcagttgcatctagagatatataatgctgtgtttatgctttaaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44492566 |
atggccaagaactatattgttcttcctagctatatgctatttttatatgcgttaatcagttgcatctagagatatataatgctgtgtttatgctttaaca |
44492665 |
T |
 |
| Q |
208 |
tattt |
212 |
Q |
| |
|
||||| |
|
|
| T |
44492666 |
tattt |
44492670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University