View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8046_low_4 (Length: 335)
Name: NF8046_low_4
Description: NF8046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8046_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 34040055 - 34039737
Alignment:
| Q |
1 |
aaagatcatgttcaagaaacaagcaatttaagcttcaaattcaatgttcaagcgcctgaattcgtgccgagatcgcattctcaaatgccgatttcgggtt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34040055 |
aaagatcatgttcaagagacaagcaattcaagcttcaaattcaatgttcaagcgcctgaattcgtgccgagatcgcattctcaaatgccgatttcgggtt |
34039956 |
T |
 |
| Q |
101 |
atttctatccttgctttcagattcttggtggttctggtgaatcagattggttctacgttggtgatcaagatccttctgcatgtttgatccctaatgctaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34039955 |
atttctatccttgctttcagattcttggtggttctggtgaatctgattggttctacgttggtgatcaagatccttctgcatgtttgatccctaatgctaa |
34039856 |
T |
 |
| Q |
201 |
tgtttcgcaacccaattgttccaagaatgtgctcaaccctgaccttcaacagaagattgttaaacaggttcttccctcttttcacgtttacattggtgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34039855 |
tgtttcgcaacccaattgttccaagaatgtgctcaaccctgaccttcaacagaagattgttaaacaggttcttccctcttttcacgtttacattggtgat |
34039756 |
T |
 |
| Q |
301 |
tgcttattaatacaaaaat |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34039755 |
tgcttattaatacaaaaat |
34039737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University