View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8047_high_12 (Length: 324)
Name: NF8047_high_12
Description: NF8047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8047_high_12 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 21 - 208
Target Start/End: Complemental strand, 13689203 - 13689016
Alignment:
| Q |
21 |
tatcgtgtcggacactggcgtgtgtcccacattgggacacacccctaatcggagaggtgtctgtgtaccaacaaaggttactagaaatgtttataagcag |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||| ||| ||||||||||| |||||||||| ||||||||| || |
|
|
| T |
13689203 |
tatcgtgtcggacactgacgtgtgtcccacatcgggacacacccctaatcggaggagtgtatgtataccaacaaagtttactagaaaagtttataaggag |
13689104 |
T |
 |
| Q |
121 |
gtacgtaaaaaagagtgacactaccggatcgagaatcaaaatgtagcctaaatatgtttattataatatgatgataagcttccaattt |
208 |
Q |
| |
|
|||||||||||||||||| |||| |||||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13689103 |
gtacgtaaaaaagagtgatactatcggatctagaatcaaaatgtagcctaagtatgtttattataatacgatgataagcttccaattt |
13689016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 223 - 306
Target Start/End: Complemental strand, 2177 - 2094
Alignment:
| Q |
223 |
gcatttcttttcccagggaaaatcgcggggatgaaaacccagttcttcgctgaaatcatgaactgttgtggttgtttacatatt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
2177 |
gcatttcttttcccagggaaaatcgcggggatgaaatcccagttcttcgctgaaatcatgacccgttgtggttgtttacatatt |
2094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University