View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8047_high_7 (Length: 404)
Name: NF8047_high_7
Description: NF8047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8047_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 124 - 381
Target Start/End: Original strand, 41375621 - 41375878
Alignment:
| Q |
124 |
ttaacatgagccgtcgaatttaattaacagtttagatttagnnnnnnnnnnnnnnnaatttaaacccctaacacaagaaatcagatactagtctttccct |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
41375621 |
ttaacatgagccgtcggatttaattaacagtttagatttagtttttttcattttttaatttaaacccctaacacaagaaatcagaacctagtcttcccct |
41375720 |
T |
 |
| Q |
224 |
tcctttcactcatcttcatcgagttctcgtcctcgtctgtcaaatagatattgcagttttcatccattttcgtcctggttgggaatctgttcatgccaaa |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375721 |
tcctttcactcatcttcatcgagttctcgtcctcgtctgtcaaatagatattgcagttttaatccattttcgtcctggttgggaatctgttcatgccaaa |
41375820 |
T |
 |
| Q |
324 |
gaagaagaacatatcatgaaaacatattggatttttaagctttttgacatgaagaggt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375821 |
gaagaagaacatatcatgaaaacatattggatttttaagctttttgacatgaagaggt |
41375878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 41375498 - 41375588
Alignment:
| Q |
19 |
tgtgagcttagttcatttgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctcca |
109 |
Q |
| |
|
||||||||||| ||| ||| |||||||||| ||||| | ||||||||| |||||||| |||||||||||||||||| | |||||||||| |
|
|
| T |
41375498 |
tgtgagcttagctcacttgtattatgtatgtaggggttggggtttgaactccggacacctcactatttcacctttaaagtgaatttctcca |
41375588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 95
Target Start/End: Complemental strand, 10621442 - 10621383
Alignment:
| Q |
36 |
tgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaa |
95 |
Q |
| |
|
||||||||||||||||||| ||||||||| | ||||||||||| | |||||||||||| |
|
|
| T |
10621442 |
tgcattatgtatgcaggggtcagggtttgaaccccggacaccccattttttcacctttaa |
10621383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 109
Target Start/End: Original strand, 30659984 - 30660054
Alignment:
| Q |
39 |
attatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctcca |
109 |
Q |
| |
|
|||||||||||||||| ||||| || | |||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30659984 |
attatgtatgcaggggtcggggttcaaaccccggacaccccactatttcacctttaaggtaaatttttcca |
30660054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 36 - 109
Target Start/End: Complemental strand, 44662530 - 44662457
Alignment:
| Q |
36 |
tgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctcca |
109 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| | |||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
44662530 |
tgcattatgtatgcaggggccggggttcgaaccccggacaccccactatttcacctttaaggtgaatttctcca |
44662457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 39 - 109
Target Start/End: Original strand, 46195949 - 46196019
Alignment:
| Q |
39 |
attatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctcca |
109 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
46195949 |
attatgtatgcaggggtcggggtttgaaccccggacaccccactatttcacctttaaggtgaatttctcca |
46196019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 36 - 108
Target Start/End: Complemental strand, 6548778 - 6548707
Alignment:
| Q |
36 |
tgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctcc |
108 |
Q |
| |
|
|||||||||||||||||| | ||||| ||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
6548778 |
tgcattatgtatgcagggccg-gggttcgaactccggacaccccactatttcacctttaaggtgaatttctcc |
6548707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 36 - 109
Target Start/End: Original strand, 24202178 - 24202251
Alignment:
| Q |
36 |
tgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctcca |
109 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| | |||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
24202178 |
tgcattatgtatgcaggggccggggttcgaaccccggacaccccactatttcacctttaaggtgaatttctcca |
24202251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 108
Target Start/End: Complemental strand, 38790130 - 38790090
Alignment:
| Q |
68 |
ctcggacaccccactatttcacctttaaaataaatttctcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38790130 |
ctcggacaccccactatttcacctttaagatgaatttctcc |
38790090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 45 - 82
Target Start/End: Complemental strand, 40473580 - 40473543
Alignment:
| Q |
45 |
tatgcaggggcttgggtttgaatctcggacaccccact |
82 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
40473580 |
tatgcaggggctggggtttgaacctcggacaccccact |
40473543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 7234002 - 7234054
Alignment:
| Q |
45 |
tatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaa |
97 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
7234002 |
tatgcaggggctggggtttgaacctcggacaccccacttattcaccttgaaaa |
7234054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000009; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 36 - 107
Target Start/End: Original strand, 9489505 - 9489576
Alignment:
| Q |
36 |
tgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaataaatttctc |
107 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| | ||| |||| |||||||||||||||| || |||||||| |
|
|
| T |
9489505 |
tgcattatgtatgcaggggccggggttcgaaccctggataccctactatttcacctttaagatgaatttctc |
9489576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 45 - 95
Target Start/End: Original strand, 27394544 - 27394594
Alignment:
| Q |
45 |
tatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaa |
95 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
27394544 |
tatgcaggggctggggtttgaaccccggacaccccacttattcacctttaa |
27394594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 40160772 - 40160824
Alignment:
| Q |
45 |
tatgcaggggcttgggtttgaatctcggacaccccactatttcacctttaaaa |
97 |
Q |
| |
|
||||| |||||| ||||||||| | ||||||||||||| ||||||||||||| |
|
|
| T |
40160772 |
tatgccggggctggggtttgaaccccggacaccccacttattcacctttaaaa |
40160824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 36 - 92
Target Start/End: Original strand, 32660858 - 32660914
Alignment:
| Q |
36 |
tgcattatgtatgcaggggcttgggtttgaatctcggacaccccactatttcacctt |
92 |
Q |
| |
|
|||||||| |||||||||||| ||||| || | ||||||||||||| ||||||||| |
|
|
| T |
32660858 |
tgcattatatatgcaggggctggggttcaaaccccggacaccccactttttcacctt |
32660914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University