View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8047_low_18 (Length: 291)
Name: NF8047_low_18
Description: NF8047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8047_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 37 - 278
Target Start/End: Complemental strand, 32752380 - 32752139
Alignment:
| Q |
37 |
cctgttctggagatttaacatttgcttgattagcaaaatcttggcttggaacaacaaaatcattttcttcagtagcaagagattcaccaagaataacagc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32752380 |
cctgttctggagatttaacatttgcttgattagcaaaatcttggcttggaacaacaaaatcattttcttcagtagcaagagattcaccaagaataacagc |
32752281 |
T |
 |
| Q |
137 |
attcaaacgaggaatgcgaccagcaccagatggaagaatcttcattgattctaaatggcgtaagtaattatttgttctgtgattcgtagacatcaaattc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32752280 |
attcaaacgaggaatgcgaccagcaccagatggaagaatcttcattgattctaaatggcgtaagtaattatttgttctgtgattcgtagacatcaaattc |
32752181 |
T |
 |
| Q |
237 |
ttatgattccttcttcttctactgctactattgatgttgttg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32752180 |
ttatgattccttcttcttctactgctactattgatgttgttg |
32752139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University