View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8047_low_19 (Length: 278)
Name: NF8047_low_19
Description: NF8047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8047_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 254
Target Start/End: Complemental strand, 42998354 - 42998120
Alignment:
| Q |
22 |
gctaaccttaaatatttgaatttttctggctaacctttttgttagaccatatcaataataaacttctaattgtcggnnnnnnnnn--tagtataaaaatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42998354 |
gctaaccttaaatatttgaatttttctggctaacctttttgttagaccatatcaataataaacttctaattgtcggaagaaaaaaaatagtataaaaata |
42998255 |
T |
 |
| Q |
120 |
catcaattaatgtatagtgaattaaatacaatctttgttgcaatgcatgtgagagttcagatgggaattgtatgtggctatgtctacgtatatggtgtaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42998254 |
catcaattaatgtatagtgaattaaatacaatctttgttgcaatgcatgtgagagttcagatgggaattgtatgtggctatgtctacgtatatggtgtaa |
42998155 |
T |
 |
| Q |
220 |
tacaagtggtagatatttgagttttttaattattt |
254 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |||| |
|
|
| T |
42998154 |
tataagtggtagatatttgagttttttaatcattt |
42998120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University