View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8048_high_15 (Length: 252)
Name: NF8048_high_15
Description: NF8048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8048_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 235
Target Start/End: Complemental strand, 18713845 - 18713631
Alignment:
| Q |
21 |
ttagttattcaccatctttcaataacaattgatgttgttcattcatcctcttcattgatctaatcttcaaaaacaactcctctttctcaatttaactaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18713845 |
ttagttattcaccatctttcaataacaattgatgttgttcattcatcctcttcattgatctaatcttcaaaaacaactcctctttctcaatttaactaaa |
18713746 |
T |
 |
| Q |
121 |
gggaattccttcaacttccaacttggttaccttagcctccaaggttgtcttctcatcggataaaccctctgcctaggctttatattcacttttcctgtga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18713745 |
gggaattccttcaacttccaacttggttaccttagcctccaaggttgtcttctcatcggataaaccctctgcctaggctttatattcacttttcctgtga |
18713646 |
T |
 |
| Q |
221 |
ggatcattctgctta |
235 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
18713645 |
ggttcattctgctta |
18713631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University