View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8048_high_9 (Length: 308)

Name: NF8048_high_9
Description: NF8048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8048_high_9
NF8048_high_9
[»] chr5 (4 HSPs)
chr5 (133-294)||(12400763-12400925)
chr5 (18-84)||(12400974-12401040)
chr5 (18-70)||(12397791-12397845)
chr5 (18-72)||(12380263-12380319)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 133 - 294
Target Start/End: Complemental strand, 12400925 - 12400763
Alignment:
133 caatggatagttgaagcaagggaccccccattgcacaaaagtgtgcctaggacatccctattgttgtgtaccgggt-tgtgtggcatctttactgttctg 231  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
12400925 caatggatagttgaagcaagggaacccccattgcacaaaagtgtgcctaggacatccctattgttgtgtactgggtatgtgtggcatctttactgttctg 12400826  T
232 gcattgaagcagtttatagtttgcaaattgtcggggcttgggtcaaccgagcatagttccttt 294  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12400825 gcattgaagcagtttatagtttgcaaattgtcggggcttgggtcaaccgagcatagttccttt 12400763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 12401040 - 12400974
Alignment:
18 tggtcctcttgatttgttactggttaggcctcttactttctatgcatatctttctccgttgtataag 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12401040 tggtcctcttgatttgttactggttaggcctcttactttctatgcatatctttctccgttgtataag 12400974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 12397845 - 12397791
Alignment:
18 tggtcctcttgatttgt--tactggttaggcctcttactttctatgcatatcttt 70  Q
    ||||||| |||||||||  ||||||||||||||||||||||||||||||||||||    
12397845 tggtccttttgatttgtattactggttaggcctcttactttctatgcatatcttt 12397791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 12380319 - 12380263
Alignment:
18 tggtcctcttgatttgt--tactggttaggcctcttactttctatgcatatctttct 72  Q
    ||||||| |||||||||  ||||||||||| |||||||||| |||||||||||||||    
12380319 tggtccttttgatttgtattactggttagggctcttactttttatgcatatctttct 12380263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University