View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8048_low_13 (Length: 308)
Name: NF8048_low_13
Description: NF8048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8048_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 133 - 294
Target Start/End: Complemental strand, 12400925 - 12400763
Alignment:
| Q |
133 |
caatggatagttgaagcaagggaccccccattgcacaaaagtgtgcctaggacatccctattgttgtgtaccgggt-tgtgtggcatctttactgttctg |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12400925 |
caatggatagttgaagcaagggaacccccattgcacaaaagtgtgcctaggacatccctattgttgtgtactgggtatgtgtggcatctttactgttctg |
12400826 |
T |
|
| Q |
232 |
gcattgaagcagtttatagtttgcaaattgtcggggcttgggtcaaccgagcatagttccttt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12400825 |
gcattgaagcagtttatagtttgcaaattgtcggggcttgggtcaaccgagcatagttccttt |
12400763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 12401040 - 12400974
Alignment:
| Q |
18 |
tggtcctcttgatttgttactggttaggcctcttactttctatgcatatctttctccgttgtataag |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12401040 |
tggtcctcttgatttgttactggttaggcctcttactttctatgcatatctttctccgttgtataag |
12400974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 12397845 - 12397791
Alignment:
| Q |
18 |
tggtcctcttgatttgt--tactggttaggcctcttactttctatgcatatcttt |
70 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12397845 |
tggtccttttgatttgtattactggttaggcctcttactttctatgcatatcttt |
12397791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 12380319 - 12380263
Alignment:
| Q |
18 |
tggtcctcttgatttgt--tactggttaggcctcttactttctatgcatatctttct |
72 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
12380319 |
tggtccttttgatttgtattactggttagggctcttactttttatgcatatctttct |
12380263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University