View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8048_low_18 (Length: 256)

Name: NF8048_low_18
Description: NF8048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8048_low_18
NF8048_low_18
[»] chr1 (1 HSPs)
chr1 (174-256)||(52793112-52793194)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 174 - 256
Target Start/End: Original strand, 52793112 - 52793194
Alignment:
174 caccacattctattctgtggtgtgtggtgttactctattttatttttgttgctcataactctacacgtaacctcctcctattc 256  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
52793112 caccacattctattctgtggtgtgtggtgtcactctattttatttttgttgctcataactctacacgtaacctcctcctattc 52793194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University