View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8048_low_20 (Length: 252)
Name: NF8048_low_20
Description: NF8048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8048_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 27986945 - 27986862
Alignment:
| Q |
10 |
aagaatatgacacatcagatgagtgagtcactcaaagcaactcttcacctctctcacgctttccctccatttactcttttttcg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27986945 |
aagaaaatgacacatcagatgagtgagtcactcaaagcaactcttcacctctctcacgctttccctccatttactcttttttcg |
27986862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 28044247 - 28044164
Alignment:
| Q |
10 |
aagaatatgacacatcagatgagtgagtcactcaaagcaactcttcacctctctcacgctttccctccatttactcttttttcg |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28044247 |
aagaaaatgacacatcagatgagtgagtcactcaaagcaactcttcacctctctcacgctttccctccatttactcttttttcg |
28044164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 232
Target Start/End: Complemental strand, 27986802 - 27986720
Alignment:
| Q |
150 |
gcataatccattctaatactcattgatcataaataataatttcataacccaatcttaattttctatatatattaacccaatgg |
232 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27986802 |
gcataattcattctaatactcattgatcataaataataatttcataacccaatcttaattttctatatatattaacccaatgg |
27986720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 232
Target Start/End: Complemental strand, 28044104 - 28044022
Alignment:
| Q |
150 |
gcataatccattctaatactcattgatcataaataataatttcataacccaatcttaattttctatatatattaacccaatgg |
232 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28044104 |
gcataattcattctaatactcattgatcataaataataatttcataacccaatcttaattttctatatatattaacccaatgg |
28044022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University