View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8049_low_3 (Length: 389)
Name: NF8049_low_3
Description: NF8049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8049_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 16 - 375
Target Start/End: Original strand, 11193790 - 11194149
Alignment:
| Q |
16 |
ctcactgaatcccctcttcttctctattctgctacacctcttttctctcatacaccctccccttattgtcacaactgcttcagaaccttaccaccttcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193790 |
ctcactgaatcccctcttcttctctattctgctacacctcttttctctcatacaccctccccttattgtcacaactgcttcagaaccttaccaccttcac |
11193889 |
T |
|
| Q |
116 |
aaacatttcaatgtccttcttgctcaaactaccttttctgcagccaaaaatgcctctccattgccctcaattcctctcattcatcttggacatgtcaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193890 |
aaacatttcaatgtccttcttgctcaaactaccttttctgcagccaaaaatgcctctccattgccctcaattcctctcattcatcttggacatgtcaaac |
11193989 |
T |
|
| Q |
216 |
actctctcatcttcaaaaccctacttcaccattatcagaaaaaccttgtgaacttcaagttcaagctcgtttgattgttgctgcttacaatcttgctatt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11193990 |
actctctcatcttcaaaaccctacttcaccattatcagaaaaaccttgtgaacttcaagttcaagctcgtttgattgttgctgcttacaatcttgctatt |
11194089 |
T |
|
| Q |
316 |
cacaccccttcaaaacttcaaactttactttcacttcatggtaatcctaatgatcaagat |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11194090 |
cacaccccttcaaaacttcaaactttactttcacttcatggtaatcctaatgatcaagat |
11194149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University