View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8049_low_4 (Length: 322)
Name: NF8049_low_4
Description: NF8049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8049_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 308
Target Start/End: Original strand, 55101526 - 55101819
Alignment:
| Q |
18 |
ctttgtagggaaaaaatgatgctaactgttcaccgtgtatatctttctgctgtacttaagttgattttgttaattactactctctgcactttatcaggtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101526 |
ctttgtagggaaaaaatgatgctaactgttcaccgtgtatatctttctgctgtacttaagttgattttgttaattactactctctgcactttatcaggtg |
55101625 |
T |
 |
| Q |
118 |
ctgcatgcacttctccttcttctgccacttctattctattctgttcttgctaatttgacttttaa---tannnnnnngctcatttcacacttgtatgcag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
55101626 |
ctgcatgcacttctccttcttctgccacttctattctattctgttcttgctaatttgacttttaattttttttttttgctcatttcacacttgtatgcag |
55101725 |
T |
 |
| Q |
215 |
attgctatgaccctttggatccaaatgggaacatttctgtaacatttgacatttaccaacgtatggaaaatggatatctggtcagtaccaagta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55101726 |
attgctatgaccctttggatccaaatgggaacatttctgtaacatttgacatttaccaacgtatggaaaatggatatctggtcagtaccaagta |
55101819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University