View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8050_high_18 (Length: 252)
Name: NF8050_high_18
Description: NF8050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8050_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 235
Target Start/End: Original strand, 11831794 - 11832020
Alignment:
| Q |
7 |
tttcgtgttgggataagctaggtgtggtagtgtgtatcactcaatgagaggcaagtacaaacaacaacaacaaatggaattttaaagttcattgcacaac |
106 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11831794 |
tttcatgttgggataagctaggtg--gtagtgtgtatcactcaatgagaggcaagtacaaacaacaacaacaaatggaattttaaagttcattgcacgac |
11831891 |
T |
 |
| Q |
107 |
atcatgagaagaatttaaagacaaaaatagccacaagatttggtgaagacacacaaactccacgaccccacctatcacgcatgcatactacatatatttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11831892 |
atcatgagaagaatttaaagacaaaaatagccacaagatttggtgaagacacacaaactccacgaccccacctatcacgcatgcatactacatatatttg |
11831991 |
T |
 |
| Q |
207 |
catctagatcctctcctgtgttgtcctct |
235 |
Q |
| |
|
||||| ||||||||||||||| ||||||| |
|
|
| T |
11831992 |
catctggatcctctcctgtgtagtcctct |
11832020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University