View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8050_high_7 (Length: 397)
Name: NF8050_high_7
Description: NF8050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8050_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 19 - 390
Target Start/End: Complemental strand, 3719724 - 3719358
Alignment:
| Q |
19 |
ttcttaaacctcagtatgtctatagtataatacataattccattccattgttggttggggctgccatttactttgctatcatccaaagattttctcagtg |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3719724 |
ttcttaaacctcagtatgtctatagaatactacataattccatt-----gttggttggtgctgccatttactttgctatcatccaaagattttctcagtg |
3719630 |
T |
 |
| Q |
119 |
tggatctgatgttaatggtttgttaagagtcaattttagcatccttacatgcatctataatatacttgtcctattaggcacctctctacaagtaactcca |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3719629 |
tggatctgatgttaatggtttgtttagagtcaattttagcatccttacatgcatctataatatacttgtcctattaggcacctctctacaagtaactcca |
3719530 |
T |
 |
| Q |
219 |
ggaccagagttggctatgagtaattccagcagcgcagctatttctatgttttgggtctctaatttcttttctcgacctccttttttattgtctttagatc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3719529 |
ggaccagagttggctatgagtaattccagcagcacagctatttctatgttttgggtctctaatttcttttctcgacctccttttttattgtctatagatc |
3719430 |
T |
 |
| Q |
319 |
cacggaaagtttatagaatgcatctatgattagggggtcacgaacgtaatctgtaagtttctttctctgcta |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3719429 |
cacggaaagtttatagaatgcatctatgattagggggtcacgaacgtaatctgtaagtttctttctctgcta |
3719358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University